Q0P412_DANRE

Ensembl ID:
ENSDARG00000063611
Description:
LOC570901 protein [Source:UniProtKB/TrEMBL;Acc:Q0P412]
Human Orthologue:
SMUG1
Human Description:
single-strand-selective monofunctional uracil-DNA glycosylase 1 [Source:HGNC Symbol;Acc:17148]
Mouse Orthologue:
Smug1
Mouse Description:
single-strand selective monofunctional uracil DNA glycosylase Gene [Source:MGI Symbol;Acc:MGI:191897

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093123 Nonsense 225 296 3 3
Genomic Location (Zv9):
Chromosome 11 (position 2135163)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2087616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCGGCAGAGCGAGACGCTCTCCTGTCCTGCTGTGACTCTGCCCTCTG[T/A]CGGGTCRTCACAGCACTGGGCATCTCCATGGTGATCGGGGTGRGGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link