LOC564681

Ensembl ID:
ENSDARG00000063610
Human Orthologue:
INTS4
Human Description:
integrator complex subunit 4 [Source:HGNC Symbol;Acc:25048]
Mouse Orthologue:
Ints4
Mouse Description:
integrator complex subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1917164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23388 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093103 Nonsense 769 979 19 24
Genomic Location:
Chromosome 18 (position 47313414)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCACATAACAGAGTCGATCGAGTTCTTGGTGTTTGTGAGAAGTTCCTG[C/T]AAGACGTGGAATCATTTCAGAGGTATTGCACTGTTTATGCTGTATAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ujrzj1cx