LOC564616

Ensembl ID:
ENSDARG00000063600
Human Orthologue:
KCTD14
Human Description:
potassium channel tetramerisation domain containing 14 [Source:HGNC Symbol;Acc:23295]
Mouse Orthologue:
Kctd14
Mouse Description:
potassium channel tetramerisation domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:1289222]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23389 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093096 Nonsense 133 241 2 2
Genomic Location:
Chromosome 18 (position 47341192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGAGAGACCGTCGGAAGGCAGCAGTTTTTAGCTCGCGTGCCCAATTA[T/A]CGAGAAAACCTGGAGGTGATCGTACGTGTGGCCAGAGCTGAGGCCATCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gcvbobak