map2k4

Ensembl ID:
ENSDARG00000063583
ZFIN IDs:
ZDB-GENE-060512-98, ZDB-GENE-060512-98
Description:
mitogen-activated protein kinase kinase 4 [Source:RefSeq peptide;Acc:NP_991299]
Human Orthologue:
MAP2K4
Human Description:
mitogen-activated protein kinase kinase 4 [Source:HGNC Symbol;Acc:6844]
Mouse Orthologue:
Map2k4
Mouse Description:
mitogen-activated protein kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346869]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1709 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa1709
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058834 Essential Splice Site 153 229 7 9
ENSDART00000093037 Essential Splice Site 276 404 8 13
ENSDART00000130761 Essential Splice Site 276 404 8 12
Genomic Location:
Chromosome 3 (position 11503878)
KASP Assay ID:
554-1655.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTCCATCGCCAAAACCAGAGACGCAGGCTGCAGACCGTATATGGCAG[T/A]AAGTTTGTTTATTCGCTTATACTGTATATACAGTACGCACTACTGTTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/730lpa4x