si:ch1073-219n12.1

Ensembl ID:
ENSDARG00000063580
ZFIN ID:
ZDB-GENE-091204-412
Human Orthologues:
PPP1R9A, SAMD14
Human Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 9A [Source:HGNC Symbol;Acc:14946]
sterile alpha motif domain containing 14 [Source:HGNC Symbol;Acc:27312]
Mouse Orthologues:
Ppp1r9a, Ppp1r9b, Samd14
Mouse Descriptions:
protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]
protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]
sterile alpha motif domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:2384945]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa733 Nonsense Available for shipment Available now
sa38721 Nonsense Mutation detected in F1 DNA During 2017
sa34545 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093021 Nonsense 252 1317 1 18
ENSDART00000139476   None 145 None 3
ENSDART00000146148   None 308 None 7
Genomic Location (Zv9):
Chromosome 9 (position 3054949)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3050421
KASP Assay ID:
554-0640.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTGGTGATGATAAAGAGTCAACRCAAGTAATCCCTGAGAAATCGAGC[A/T]GACCTATACAGGYAAGTTTCCAAAAAACAAGCTCACCTGCAACTGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093021 Nonsense 784 1317 7 18
ENSDART00000139476   None 145 None 3
ENSDART00000146148 Nonsense 231 308 6 7
Genomic Location (Zv9):
Chromosome 9 (position 3098732)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3094204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCAGATAAAGCACACCATCGCAGAAGCTGAAGTGGATGAGCTGAAA[G/T]AGAGAGTATGAACCTGTAAACCATTTACATTTGAAATCAGAATCATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093021 Nonsense 893 1317 9 18
ENSDART00000139476   None 145 None 3
ENSDART00000146148   None 308 None 7
Genomic Location (Zv9):
Chromosome 9 (position 3104539)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3100011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGATGAAAGAGAGAGCGCATATAAGAGTCAGATCGAGGATCTGCAG[C/T]GAAGGGTGAGAACTCACATCATACAGACAAAATCACTCGCACATAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link