DGKI

Ensembl ID:
ENSDARG00000063578
Description:
diacylglycerol kinase, iota [Source:HGNC Symbol;Acc:2855]
Human Orthologue:
DGKI
Human Description:
diacylglycerol kinase, iota [Source:HGNC Symbol;Acc:2855]
Mouse Orthologue:
Dgki
Mouse Description:
diacylglycerol kinase, iota Gene [Source:MGI Symbol;Acc:MGI:2443430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9623 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093005 Essential Splice Site 373 968 12 33
Genomic Location (Zv9):
Chromosome 4 (position 4514674)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4632623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAAAGTGCCAAATCTTCGCATCCTGGCCTGTGGAGGAGATGGAACC[G/A]TAAGACGCAGTGCATGATGGGAAAAYTTTTGTCTATATTGAAATGAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link