si:ch73-211p17.3

Ensembl ID:
ENSDARG00000063577
ZFIN ID:
ZDB-GENE-091118-66
Human Orthologue:
KLHL35
Human Description:
kelch-like 35 (Drosophila) [Source:HGNC Symbol;Acc:26597]
Mouse Orthologue:
Klhl35
Mouse Description:
kelch-like 35 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1919434]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31757 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093028 Essential Splice Site 508 568 6 7
ENSDART00000136551   None 498 None 7
Genomic Location (Zv9):
Chromosome 10 (position 301532)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 236427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAGTAAAGACTGCTGGAGTCCTGCTGCCAAACTGCCCGTCAGAGTG[G/T]TGCGCACACACACACTATATACACAAACACACTATACACACACACACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link