gtpbp5

Ensembl ID:
ENSDARG00000063574
ZFIN ID:
ZDB-GENE-030131-2209
Human Orthologue:
GTPBP5
Human Description:
GTP binding protein 5 (putative) [Source:HGNC Symbol;Acc:16239]
Mouse Orthologue:
Gtpbp5
Mouse Description:
GTP binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:106565]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14620 Essential Splice Site Available for shipment Available now
sa45782 Nonsense Mutation detected in F1 DNA During 2018
sa17626 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092873 Essential Splice Site 50 337 1 6
ENSDART00000128788 Essential Splice Site 88 369 2 6
Genomic Location (Zv9):
Chromosome 23 (position 567956)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 538947
GRCz11 23 551740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCGGATGGAGGAGACGGCGGCGCTGGCGGACACATCAKCATCAGAGG[T/G]CAGATTCACMGCAATACTTGTGCTTATTGTTAGTGAGGTGTGCACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092873 Nonsense 79 337 2 6
ENSDART00000128788 Nonsense 117 369 3 6
Genomic Location (Zv9):
Chromosome 23 (position 567788)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 538779
GRCz11 23 551572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTATCGGGGCAGAGATGGAGAGGCAGGAGGCAGCAAAAACTGCTTC[G/T]GACGCAACGCCAACCCCACATACATCTCTGTGAGTTACACACACTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092873 Nonsense 264 337 5 6
ENSDART00000128788 Nonsense 301 369 6 6
Genomic Location (Zv9):
Chromosome 23 (position 563936)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 534927
GRCz11 23 547720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGAGCCCTGGGAACAGTTCCAGCAGCTGTGCTTCGAGCTGGAYCAGTA[C/A]AGGCCTCTGTTTTCACAAAGACCACATGCCATCGTAGCCAACAAAATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link