gtpbp5

Ensembl ID:
ENSDARG00000063574
ZFIN ID:
ZDB-GENE-030131-2209
Human Orthologue:
GTPBP5
Human Description:
GTP binding protein 5 (putative) [Source:HGNC Symbol;Acc:16239]
Mouse Orthologue:
Gtpbp5
Mouse Description:
GTP binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:106565]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14620 Essential Splice Site Available for shipment Available now
sa17626 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092873 Essential Splice Site 50 337 1 6
ENSDART00000128788 Essential Splice Site 88 369 2 6
Genomic Location:
Chromosome 23 (position 567956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCGGATGGAGGAGACGGCGGCGCTGGCGGACACATCAKCATCAGAGG[T/G]CAGATTCACMGCAATACTTGTGCTTATTGTTAGTGAGGTGTGCACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092873 Nonsense 264 337 5 6
ENSDART00000128788 Nonsense 301 369 6 6
Genomic Location:
Chromosome 23 (position 563936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGAGCCCTGGGAACAGTTCCAGCAGCTGTGCTTCGAGCTGGAYCAGTA[C/A]AGGCCTCTGTTTTCACAAAGACCACATGCCATCGTAGCCAACAAAATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt0od5cd