si:ch211-146l10.2

Ensembl ID:
ENSDARG00000063573
ZFIN ID:
ZDB-GENE-030131-6671
Human Orthologue:
VPS41
Human Description:
vacuolar protein sorting 41 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:12713]
Mouse Orthologue:
Vps41
Mouse Description:
vacuolar protein sorting 41 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929215]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30047 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44094 Nonsense Mutation detected in F1 DNA During 2017
sa24448 Nonsense Available for shipment Available now
sa18279 Essential Splice Site Available for shipment Available now
sa24447 Essential Splice Site Available for shipment Available now
sa37829 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 190 854 8 29
ENSDART00000143390 Essential Splice Site 190 855 8 29
ENSDART00000145845 Essential Splice Site 171 736 6 24
Genomic Location (Zv9):
Chromosome 24 (position 9730239)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9789123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGTGTGAAATGGAGAGGAAATCTTATCGCCTGGGCAAACAATGTGG[T/A]ACGGACAGATTAAAATATGATAATCATGATGCGTTTCTCACAGGACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Nonsense 258 854 10 29
ENSDART00000143390 Nonsense 258 855 10 29
ENSDART00000145845 Nonsense 239 736 8 24
Genomic Location (Zv9):
Chromosome 24 (position 9728228)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9787112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTAAAGAGCGTGACCCAACAGAGATGAGGGATCTACCCAGTCGCTA[T/A]GTTGAGATCGGTATTGCTATGTTCACTACTGAATCTCTTATAAAAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Nonsense 370 854 13 29
ENSDART00000143390 Nonsense 370 855 13 29
ENSDART00000145845 Nonsense 351 736 11 24
Genomic Location (Zv9):
Chromosome 24 (position 9722666)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9781550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGTAGTGGCTAAAGAAAGAGACCAGGATGACCACATTGACTGGCTTT[T/A]GGAGAAGAAGAAATATGAGGTACATGTCTAAGCAGTATGTATTGTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 395 854 None 29
ENSDART00000143390 Essential Splice Site 396 855 None 29
ENSDART00000145845 Essential Splice Site 377 736 None 24
Genomic Location (Zv9):
Chromosome 24 (position 9720508)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9779392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCAGCAGAGATCAGCTTTAAAAATATTAAAAGGCATGATGTACAGG[T/A]AAAATCAAATGGCAAATGTGGATTAWTGAAGTGYGGAAGAATNNNNNNNNTATTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975 Essential Splice Site 517 854 19 29
ENSDART00000143390 Essential Splice Site 518 855 19 29
ENSDART00000145845 Essential Splice Site 499 736 17 24
Genomic Location (Zv9):
Chromosome 24 (position 9714311)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9773195
KASP Assay ID:
2261-8453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATAGACCCCCCACCCACTTGCTAATATGTATGTGTTTGTTATGTAT[A/G]GATACACATATGATCAACGTTATGATCGAGCTCTGGAAATCTACCTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092975   None 854 None 29
ENSDART00000143390   None 855 None 29
ENSDART00000145845 Essential Splice Site None 736 23 24
Genomic Location (Zv9):
Chromosome 24 (position 9706699)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9765583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAACAGCATGATTTTTTGGCCGCATTTAATGTCAATGTCAATGGCA[C/T]TATTATGGCCCATTTCTACTGAGTGGTACGGTATGCTTTGGTTCAGTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link