dyrk1aa

Ensembl ID:
ENSDARG00000063570
ZFIN ID:
ZDB-GENE-050302-29
Description:
dual specificity tyrosine-phosphorylation-regulated kinase 1A [Source:RefSeq peptide;Acc:NP_0010741
Human Orthologue:
DYRK1A
Human Description:
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A [Source:HGNC Symbol;Acc:3091]
Mouse Orthologue:
Dyrk1a
Mouse Description:
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27522 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15575 Nonsense Available for shipment Available now
sa21625 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100073 Essential Splice Site 75 734 None 11
ENSDART00000141723 Essential Splice Site 75 226 None 5
ENSDART00000144722 Essential Splice Site 71 222 None 7

The following transcripts of ENSDARG00000063570 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 210310)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 73478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACTGATGGACACTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGC[A/C]GGTAACTGCTGATATGGTGATGCTGCAGAGGCGGATGCCTCAGTGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100073 Nonsense 621 734 11 11
ENSDART00000141723   None 226 None 5
ENSDART00000144722   None 222 None 7

The following transcripts of ENSDARG00000063570 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 220539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 63550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACCACCATCAYCACCACCACCCGCCGCCRCATGGACAGGGCCCTGCC[C/T]GACCTCGACCCCGGCTCTACTCTCCGTCCCACAGCGCCTCCACGCAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100073 Nonsense 623 734 11 11
ENSDART00000141723   None 226 None 5
ENSDART00000144722   None 222 None 7

The following transcripts of ENSDARG00000063570 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 220545)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 63544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCATCACCACCACCCGCCGCCGCATGGACAGGGCCCTGCCCGACCT[C/T]GACCCCGGCTCTACTCTCCGTCCCACAGCGCCTCCACGCAGGACTCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HIV-1 replication: Genome-wide association study identifies single nucleotide polymorphism in DYRK1A associated with replication of HIV-1 in monocyte-derived macrophages. (View Study)
  • Metabolic syndrome: A genome-wide association study of the metabolic syndrome in Indian Asian men. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link