si:ch211-268f14.1

Ensembl ID:
ENSDARG00000063560
ZFIN ID:
ZDB-GENE-070705-260
Description:
potassium channel subfamily K member 9 [Source:RefSeq peptide;Acc:NP_001122021]
Human Orthologue:
KCNK9
Human Description:
potassium channel, subfamily K, member 9 [Source:HGNC Symbol;Acc:6283]
Mouse Orthologue:
Kcnk9
Mouse Description:
potassium channel, subfamily K, member 9 Gene [Source:MGI Symbol;Acc:MGI:3521816]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23418 Nonsense Available for shipment Available now
sa7466 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092988 Nonsense 11 490 1 2
ENSDART00000135163   None 399 None 2
Genomic Location (Zv9):
Chromosome 19 (position 5296256)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4547512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGGAGCGCGCTAGTTGATGGCACTGCGCGCCGGGAGGACTTTGCTGTG[G/A]TTCGGGCAGGTTTTGCGCAGAGTTTCGCGGCTGCAGGGCTTGTGGTCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092988 Missense 421 490 2 2
ENSDART00000135163 Missense 330 399 2 2
Genomic Location (Zv9):
Chromosome 19 (position 5363085)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4614341
KASP Assay ID:
554-4330.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGTTCGGGAGCTCGGTCGGCCTCGGGTTGGGATTGGGAGGAGGTGGC[G/A]GAGGTGCGTTTCCGCAGCAGAACTCATTCGGCTCKCAGTTGAGCCCGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link