pigx

Ensembl ID:
ENSDARG00000063559
ZFIN ID:
ZDB-GENE-070705-212
Description:
phosphatidylinositol-glycan biosynthesis class X protein [Source:RefSeq peptide;Acc:NP_001119908]
Human Orthologue:
PIGX
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class X [Source:HGNC Symbol;Acc:26046]
Mouse Orthologue:
Pigx
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class X Gene [Source:MGI Symbol;Acc:MGI:1919334]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37405 Nonsense Mutation detected in F1 DNA During 2017
sa14619 Essential Splice Site Available for shipment Available now
sa18479 Nonsense Available for shipment Available now
sa6688 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092991 Nonsense 6 243 1 6
ENSDART00000131110 Nonsense 6 232 1 6
Genomic Location (Zv9):
Chromosome 22 (position 2180099)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2921189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTTGGGATTAGAGCATGAGCGCGGATCAATGATGGTTTATTTATA[T/A]TTATTAGCAACGGTGTTGTGTTTTATTCATCATGGAAATGCGCAAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092991 Essential Splice Site 23 243 None 6
ENSDART00000131110 Essential Splice Site 23 232 None 6
Genomic Location (Zv9):
Chromosome 22 (position 2180048)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2921138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTAGCRACGGTGTTGTGTTTTATYCATCATGGAAATGCGCAAGAAGG[T/A]ATTTATGATGCTAAACATACTGGTTAATGTTGGTTTATGTATGAGTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092991 Nonsense 80 243 3 6
ENSDART00000131110 Nonsense 80 232 3 6
Genomic Location (Zv9):
Chromosome 22 (position 2179627)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2920717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNCNNCCAGCTTTACTAGTGCASAAGATGCCGAGKGGAGTTTACATGGATGAATA[T/A]CAGCTGGAGACTCTGAGACAKGACACRGGCTTGGAGGTATGTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092991 Essential Splice Site 167 243 4 6
ENSDART00000131110   None 232 None 6
Genomic Location (Zv9):
Chromosome 22 (position 2176391)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2917481
KASP Assay ID:
554-4826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGATCAGACCAGTGTACGTCAATCCTCATATCAAYAGATTCAGAAGG[T/C]GGAGAGCAGTTGTTACTACTACACCGTGATGTTCACCTTCATTGTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link