si:ch211-248g20.5

Ensembl ID:
ENSDARG00000063558
ZFIN ID:
ZDB-GENE-091204-478
Description:
Novel protein similar to mouse and human Rho guanine nucleotide exchange factor (GEF) 17 (ARHGEF17)
Human Orthologue:
ARHGEF17
Human Description:
Rho guanine nucleotide exchange factor (GEF) 17 [Source:HGNC Symbol;Acc:21726]
Mouse Orthologue:
Arhgef17
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 17 Gene [Source:MGI Symbol;Acc:MGI:2673002]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11001 Nonsense Available for shipment Available now
sa9488 Nonsense Available for shipment Available now
sa4732 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa11001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092977 Nonsense 89 1035 3 20
ENSDART00000144057 Nonsense 28 991 2 19
Genomic Location (Zv9):
Chromosome 18 (position 2227652)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2753392
KASP Assay ID:
2261-1696.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGCMGGTTTGTTTKAGATCTGTCTTTGTGTTTTTGGGTGCAGGGCTA[C/A]ATGAAGCCGCTGAAGCATCCAGAAAACCCGCCTYTGTGTGACCCGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092977 Nonsense 192 1035 5 20
ENSDART00000144057 Nonsense 131 991 4 19
Genomic Location (Zv9):
Chromosome 18 (position 2219263)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2745003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTAATTGTCTGTAATTGTTTGTCTTTCCTCTTCAGCAAAGCATGCGT[G/T]AGAACAGAGARAAACAAGCTCTGGGTGACCTGATGAYAAAGCCGGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4732
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092977 Nonsense 352 1035 9 20
ENSDART00000144057 Nonsense 292 991 8 19
Genomic Location (Zv9):
Chromosome 18 (position 2215410)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2741150
KASP Assay ID:
554-3506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGTCATCGACACCTCCAGTAAATACAAGTTCCTGTGGAAACTGCCTT[T/G]RGAAGACATAGAGGTGGTGAAAGGTAGNNTNNTATTATCATCTGAATATTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link