rlf

Ensembl ID:
ENSDARG00000063553
ZFIN ID:
ZDB-GENE-050208-257
Description:
Novel protein similar to human rearranged L-myc fusion sequence (RLF) [Source:UniProtKB/TrEMBL;Acc:Q
Human Orthologue:
RLF
Human Description:
rearranged L-myc fusion [Source:HGNC Symbol;Acc:10025]
Mouse Orthologue:
Rlf
Mouse Description:
rearranged L-myc fusion sequence Gene [Source:MGI Symbol;Acc:MGI:1924705]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23079 Nonsense Available for shipment Available now
sa9124 Nonsense Mutation detected in F1 DNA During 2017
sa36408 Nonsense Mutation detected in F1 DNA During 2017
sa36409 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092941 Nonsense 451 2021 8 8
Genomic Location (Zv9):
Chromosome 17 (position 24425759)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24579201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCTGTGAGCTGCTACTTTCTCTGAAAGCACATTGGCCCATTGACCCT[G/T]AATTCTGGGACTGGAAAACTTTAAAACGCTACTGCATTCAGTTGCTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092941 Nonsense 647 2021 8 8
Genomic Location (Zv9):
Chromosome 17 (position 24426348)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24579790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCCTTCACTTGCCATGTACTACCAGTCCACCCATGATCCTGTAGTAT[T/A]GGAACATATATTAGAGAAAGCTGCCAGTGTGCCTGAAAAGCAAGTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092941 Nonsense 743 2021 8 8
Genomic Location (Zv9):
Chromosome 17 (position 24426635)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24580077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGAAATGCACTTTCTGCCGGAAGACATTCATGACCGCCTATCACCAT[C/T]GACTGCACCGTTGGATTCATTATGGGGATGATCCTTACATGTGTGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092941 Nonsense 1092 2021 8 8
Genomic Location (Zv9):
Chromosome 17 (position 24427682)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24581124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAACACATGACAATAATAAAGATGTATCTGATAAGAAGCAAAAAAAA[G/T]AATCTGTCTCAGAGGAGGAACAACCACAAAGCAAGTCCTTAACCAAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link