si:ch211-248g20.3

Ensembl ID:
ENSDARG00000063549
ZFIN ID:
ZDB-GENE-091204-458
Human Orthologue:
P2RY2
Human Description:
purinergic receptor P2Y, G-protein coupled, 2 [Source:HGNC Symbol;Acc:8541]
Mouse Orthologue:
P2ry2
Mouse Description:
purinergic receptor P2Y, G-protein coupled 2 Gene [Source:MGI Symbol;Acc:MGI:105107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10658 Nonsense Available for shipment Available now
sa16925 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092965 Nonsense 24 341 1 1
Genomic Location (Zv9):
Chromosome 18 (position 2099879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2625619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCTCAGACAGATCTGGATCAGAATGGCAAYGAACAACACCACTGTAT[C/A]AACGAATGRCATTGACATTTACCGYTGTACTTTAAAAGAAGACTTCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092965 Nonsense 160 341 1 1
Genomic Location (Zv9):
Chromosome 18 (position 2100288)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2626028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATCCGGTGCGGTCTTTRTCCTGGATGAACGSCCGCCRTGCTCGTTG[G/A]ATCTCGGTGGGAATATGGSTGWTCATACTYATYTTACAGACCCCACTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insomnia (caffeine-induced): A genome-wide association study of caffeine-related sleep disturbance: confirmation of a role for a common variant in the adenosine receptor. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link