si:ch211-248g20.1

Ensembl ID:
ENSDARG00000063545
ZFIN ID:
ZDB-GENE-091204-455
Human Orthologue:
P2RY2
Human Description:
purinergic receptor P2Y, G-protein coupled, 2 [Source:HGNC Symbol;Acc:8541]
Mouse Orthologue:
P2ry2
Mouse Description:
purinergic receptor P2Y, G-protein coupled 2 Gene [Source:MGI Symbol;Acc:MGI:105107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15998 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092962 Nonsense 92 329 1 1
ENSDART00000133984 Nonsense 92 329 2 2
Genomic Location (Zv9):
Chromosome 18 (position 2070105)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2595845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCACTCTTCCGTTTYTMATCTACTACTACRCCGATGAGAAYGCATG[G/A]CCGTTTGGTGAACTGATGTGTAAATTAATCCGCTTTCTCTTCTACACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insomnia (caffeine-induced): A genome-wide association study of caffeine-related sleep disturbance: confirmation of a role for a common variant in the adenosine receptor. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link