COL4A3BP (1 of 2)

Ensembl ID:
ENSDARG00000063542
Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Human Orthologue:
COL4A3BP
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein [Source:HGNC Symbol;Acc:2205]
Mouse Orthologue:
Col4a3bp
Mouse Description:
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7945 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013851 Nonsense 367 483 11 13
ENSDART00000108553 Nonsense 394 510 12 14
Genomic Location:
Chromosome 21 (position 2356124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNTGTGTGTGTTCAGAGAGTGTGGCCGGCGTCCCAGAGAGATGTCTTATA[T/G]CTGTCTGCCAWCCGCAAGATTATGGCCAATAATGAGAACGACCCAGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jpld4cg2