foxo1a

Ensembl ID:
ENSDARG00000063540
ZFIN ID:
ZDB-GENE-061013-59
Description:
forkhead box O1 a [Source:RefSeq peptide;Acc:NP_001070725]
Human Orthologue:
FOXO1
Human Description:
forkhead box O1 [Source:HGNC Symbol;Acc:3819]
Mouse Orthologue:
Foxo1
Mouse Description:
forkhead box O1 Gene [Source:MGI Symbol;Acc:MGI:1890077]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092954 Nonsense 466 469 2 2
Genomic Location:
Chromosome 16 (position 6068540)
KASP Assay ID:
554-0752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCAACAGGGGTTCGTGCCTCACAGTGTAAAGACCACCACTCACAGCT[G/A]GGTGTCTGGGTAGGACCACCANNNTTCTTCTTTTTTTCTTGGAAATCAATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/770yu9b3