si:ch211-51m24.3

Ensembl ID:
ENSDARG00000063535
ZFIN ID:
ZDB-GENE-041111-187
Description:
chromodomain helicase DNA binding protein 4 [Source:RefSeq peptide;Acc:NP_001038323]
Human Orthologue:
CHD4
Human Description:
chromodomain helicase DNA binding protein 4 [Source:HGNC Symbol;Acc:1919]
Mouse Orthologue:
Chd4
Mouse Description:
chromodomain helicase DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1344380]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23422 Essential Splice Site Available for shipment Available now
sa23421 Nonsense Available for shipment Available now
sa39225 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23420 Nonsense Available for shipment Available now
sa3029 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa23422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 475 1930 9 40
ENSDART00000092923 Essential Splice Site 476 1929 10 40
ENSDART00000130062 Essential Splice Site 476 1929 10 41
Genomic Location (Zv9):
Chromosome 19 (position 5663238)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5122549
KASP Assay ID:
2261-2843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGCCCGAGATCCCCAACGGAGAGTGGATCTGCCCTCGCTGCACTG[T/C]GAGTCAAACATGCTAGAGCTTAAAGGTCTGAGGTCAGACTGTTTTCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 632 1930 12 40
ENSDART00000092923 Nonsense 633 1929 13 40
ENSDART00000130062 Nonsense 633 1929 13 41
Genomic Location (Zv9):
Chromosome 19 (position 5659159)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5118470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAGAAGAACAACTGTCACTACCTCATCAAATGGAGGGACTTAACATA[T/A]GATCAAGCCACATGGGAGTTGGAGGATATGGATTTACCAGACTATGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Essential Splice Site 658 1930 12 40
ENSDART00000092923 Essential Splice Site 659 1929 13 40
ENSDART00000130062 Essential Splice Site 659 1929 13 41
Genomic Location (Zv9):
Chromosome 19 (position 5659080)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5118391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTACCAGACTATGACACGTATAAACTGCAGTACTGGAACCACAGG[T/C]ATATACATGTACATAGACATTAATATTGACAACACAAACAGAATGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 683 1930 13 40
ENSDART00000092923 Nonsense 684 1929 14 40
ENSDART00000130062 Nonsense 684 1929 14 41
Genomic Location (Zv9):
Chromosome 19 (position 5657328)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5116639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAACCAGGAAAGAAGATCAAGATCAAAGGGAAGATGCGCAAACTGGAC[C/T]GACCTCCAGAGAATCCTGTCGTGGATGTAAGCAAGCATTTTTCATTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3029
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005453 Nonsense 1910 1930 39 40
ENSDART00000092923 Nonsense 1909 1929 40 40
ENSDART00000130062 Nonsense 1909 1929 40 41
Genomic Location (Zv9):
Chromosome 19 (position 5627605)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5086916
KASP Assay ID:
554-3401.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCATCGCCAGGATACCGCCTGTTGCAGTGAGGCTGCAGATGTCWGAA[A/T]GAAACATTCTCAGCCGTTTGGCCAGCAGAGGACCAGACACACMGAGTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link