A0JMQ5_DANRE

Ensembl ID:
ENSDARG00000063527
Description:
LOC100006857 protein [Source:UniProtKB/TrEMBL;Acc:A0JMQ5]
Human Orthologue:
ELMO2
Human Description:
engulfment and cell motility 2 [Source:HGNC Symbol;Acc:17233]
Mouse Orthologue:
Elmo2
Mouse Description:
engulfment and cell motility 2, ced-12 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2153045]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17632 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092903 Essential Splice Site 348 541 10 15
Genomic Location:
Chromosome 11 (position 157360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGTCCGAGAGAATGAGCCAAGATGACTTCCAGTCGCCGCCCATCATG[T/C]GAGTCCAGAAGACCAGCAGTGAACACCCAGATCATCCTCAGAGCAGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h7tni5r4