A0JMQ5_DANRE

Ensembl ID:
ENSDARG00000063527
Description:
LOC100006857 protein [Source:UniProtKB/TrEMBL;Acc:A0JMQ5]
Human Orthologue:
ELMO2
Human Description:
engulfment and cell motility 2 [Source:HGNC Symbol;Acc:17233]
Mouse Orthologue:
Elmo2
Mouse Description:
engulfment and cell motility 2, ced-12 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2153045]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17632 Essential Splice Site Available for shipment Available now
sa41743 Nonsense Mutation detected in F1 DNA During 2016
sa34996 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092903 Essential Splice Site 348 541 10 15
Genomic Location:
Chromosome 11 (position 157360)
KASP Assay ID:
2260-3748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGTCCGAGAGAATGAGCCAAGATGACTTCCAGTCGCCGCCCATCATG[T/C]GAGTCCAGAAGACCAGCAGTGAACACCCAGATCATCCTCAGAGCAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092903 Nonsense 410 541 12 15
Genomic Location:
Chromosome 11 (position 155032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACTGAACCACAAGCTGCTCCATTATGGGGATCTGGAGGAGTCTCCA[C/T]AGGGTGAGGTGCCACTGGAGCTGCTGACCGACAAGAGTGAGTGCTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092903 Essential Splice Site 476 541 15 15
Genomic Location:
Chromosome 11 (position 151088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCACCA[G/T]TACTGTATCTGGACAGACGGCCTGTCAGCTCTGCTAGGGAAGGATCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link