adpgk

Ensembl ID:
ENSDARG00000063525
ZFIN ID:
ZDB-GENE-061103-421
Description:
ADP-dependent glucokinase [Source:RefSeq peptide;Acc:NP_001073434]
Human Orthologue:
ADPGK
Human Description:
ADP-dependent glucokinase [Source:HGNC Symbol;Acc:25250]
Mouse Orthologue:
Adpgk
Mouse Description:
ADP-dependent glucokinase Gene [Source:MGI Symbol;Acc:MGI:1919391]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24587 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113382 Nonsense 279 498 6 9
ENSDART00000143721 Nonsense 279 498 6 8
Genomic Location:
Chromosome 25 (position 2652327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCATATGATGGAAGGAATGGGCCGGGAACTCTGGGAGGAACGACTC[A/T]AAGAGGTCTGACACCAAAATCACTCAATGCACGTTTATTTGAAACAGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i5n2n4hi