ano2

Ensembl ID:
ENSDARG00000063524
ZFIN ID:
ZDB-GENE-060503-62
Description:
anoctamin 2 [Source:RefSeq peptide;Acc:NP_001103862]
Human Orthologue:
ANO2
Human Description:
anoctamin 2 [Source:HGNC Symbol;Acc:1183]
Mouse Orthologue:
Ano2
Mouse Description:
anoctamin 2 Gene [Source:MGI Symbol;Acc:MGI:2387214]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40208 Nonsense Mutation detected in F1 DNA During 2016
sa31370 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33366 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40209 Nonsense Mutation detected in F1 DNA During 2016
sa20190 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31371 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33367 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 63 984 1 24
ENSDART00000109788 Nonsense 77 998 2 25
Genomic Location:
Chromosome 4 (position 4145929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTCCAATGGAAGTTATCATTTAGGAGTGGAGGAAAAAGACCCAGAA[G/T]GAGGGAAAGAGGAGCCTGCGGAGGTGGTGGTTGATGTTGGACCACCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 142 984 3 24
ENSDART00000109788 Essential Splice Site 156 998 4 25
Genomic Location:
Chromosome 4 (position 4163112)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTGTTTCCATGCTTCACTGATAATAATAAACACTGTGTCTTGTTCA[G/A]AGTTACGAGCTGAGGGAAGAAAAAGGTCTGGCCGCCACTATGAATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 229 984 5 24
ENSDART00000109788 Essential Splice Site 243 998 6 25
Genomic Location:
Chromosome 4 (position 4163792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGAAATCCTCAGACGCACAGCCTGCACACGGACCTGCCAAACCATGG[G/A]TTAGTAATGTGTAAATCCATAACCTAAGCATGGACTAGCGTTCAGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 258 984 7 24
ENSDART00000109788 Nonsense 272 998 8 25
Genomic Location:
Chromosome 4 (position 4166648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGTTTTTCTATGATTTCAGGGTGACTTCCACTCCTCTGGACAAGCC[G/T]AGGGAAAAAACGAAAGACAAGTATGTTGCTACCACAATGCAAATAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 561 984 16 24
ENSDART00000109788 Essential Splice Site 575 998 17 25
Genomic Location:
Chromosome 4 (position 4201649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGAACTCATCTCTCTGAACCCTACATAATATCACTTCATGTGTCTGC[A/T]GAGATCCCGAAAACTGAGACCAACTTTGAAGAGCGTCTGATTCTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Essential Splice Site 825 984 23 24
ENSDART00000109788 Essential Splice Site 839 998 24 25
Genomic Location:
Chromosome 4 (position 4225586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCAAGAACTGAATGAGCCCTTAATGACTTTTTCATTTTGTATATTTT[A/T]GGTACAAGGACTACAGAGAGCCTCCATGGTCGAATGAGCCTTACCAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092932 Nonsense 872 984 24 24
ENSDART00000109788 Nonsense 886 998 25 25
Genomic Location:
Chromosome 4 (position 4228161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCACTTCCTCCAGAACCTGGTGATAATCATGAGCATGCTGGTGGCCTG[G/A]CTGATCCCGGACATGCCCAAAAACATCAGTGAGCAGTTAAAGAAGGACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link