bbs4

Ensembl ID:
ENSDARG00000063522
ZFIN ID:
ZDB-GENE-060126-2
Description:
Bardet-Biedl syndrome 4 [Source:RefSeq peptide;Acc:NP_001070934]
Human Orthologue:
BBS4
Human Description:
Bardet-Biedl syndrome 4 [Source:HGNC Symbol;Acc:969]
Mouse Orthologue:
Bbs4
Mouse Description:
Bardet-Biedl syndrome 4 (human) Gene [Source:MGI Symbol;Acc:MGI:2143311]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa258 Nonsense F2 line generated During 2014
sa11279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa258
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092919 Nonsense 160 359 8 16
ENSDART00000122929 Nonsense 160 528 8 16

The following transcripts of ENSDARG00000063522 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 2624919)
KASP Assay ID:
554-2691.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGGTTTCTGTTCTCTCCGTGTCTGCAGGCAGAAGAGCAGTTAAACT[T/A]GGCATTACAGCTGAATAAACACGATCTGACCTACATGATGCTGGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092919 Nonsense 298 359 12 16
ENSDART00000122929 Nonsense 298 528 12 16

The following transcripts of ENSDARG00000063522 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 2636410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCTTTTGATATTTMAGGCCATCAGCTGTCTGAAGAGAGCGAATTA[T/G]CTGTCTCCKTTTGACTGGAAGATTYTGTATAATCTGGGTTTGGTTCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b59ogilr