abcg1

Ensembl ID:
ENSDARG00000063475
ZFIN ID:
ZDB-GENE-070424-84
Description:
ATP-binding cassette sub-family G member 1 [Source:RefSeq peptide;Acc:NP_001103924]
Human Orthologue:
ABCG1
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 1 [Source:HGNC Symbol;Acc:73]
Mouse Orthologue:
Abcg1
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 1 Gene [Source:MGI Symbol;Acc:MGI:107704]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22581 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092809 Essential Splice Site 102 673 2 15
Genomic Location:
Chromosome 15 (position 4892471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACCTCTCGTATTCCGTTCCTGAAGGACCATGGTGGAGGAAAAAAG[G/A]TAACGTGTGACCTTTTAAATGGCATTCTGAGGTAAATAAAAGTATTAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gn5hva7h