abcg1

Ensembl ID:
ENSDARG00000063475
ZFIN ID:
ZDB-GENE-070424-84
Description:
ATP-binding cassette sub-family G member 1 [Source:RefSeq peptide;Acc:NP_001103924]
Human Orthologue:
ABCG1
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 1 [Source:HGNC Symbol;Acc:73]
Mouse Orthologue:
Abcg1
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 1 Gene [Source:MGI Symbol;Acc:MGI:107704]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22581 Essential Splice Site Available for shipment Available now
sa35797 Nonsense Mutation detected in F1 DNA During 2016
sa35798 Nonsense Mutation detected in F1 DNA During 2016
sa35799 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092809 Essential Splice Site 102 673 2 15
Genomic Location (Zv9):
Chromosome 15 (position 4892471)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5042524
KASP Assay ID:
2260-8102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACCTCTCGTATTCCGTTCCTGAAGGACCATGGTGGAGGAAAAAAG[G/A]TAACGTGTGACCTTTTAAATGGCATTCTGAGGTAAATAAAAGTATTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092809 Nonsense 282 673 7 15
Genomic Location (Zv9):
Chromosome 15 (position 4922023)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5072076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGGCTCTCGCTCAGGGTGGAAGAACCGTCATCTGCACAATACAC[C/T]AGCCCAGCGCTAAAGTCTTCGAGCTCTTCGACAAGGTGATAGTTGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092809 Nonsense 361 673 9 15
Genomic Location (Zv9):
Chromosome 15 (position 4926122)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5076175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCGTCTGGTGAAAGCTGTGCAGGAGCACAAGTGCGAGAAAGACTAC[A/T]AAACTGAAATGAATGGCAACGGAGTCCACAATCCATTCCTGTGGCATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092809 Nonsense 491 673 12 15
Genomic Location (Zv9):
Chromosome 15 (position 4927802)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5077855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGATGGGTGTGTTTTTGAGAGAGCATCTAAATTACTGGTACAGTCTG[A/T]AGGCTTACTACTTAGCCAAAACAATGGCGGACGTCCCGTTTCAGGTAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link