arfgef1

Ensembl ID:
ENSDARG00000063474
ZFIN ID:
ZDB-GENE-030131-108
Description:
Im:7138204 protein [Source:UniProtKB/TrEMBL;Acc:Q6DEJ1]
Human Orthologue:
ARFGEF1
Human Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) [Source:HGNC Sym
Mouse Orthologue:
Arfgef1
Mouse Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) Gene [Source:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4277 Nonsense Mutation detected in F1 DNA During 2014
sa14568 Nonsense Available for shipment Available now
sa17540 Essential Splice Site Available for shipment Available now
sa778 Nonsense F2 line generated During 2014
sa10355 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 652 1849 14 39
Genomic Location:
Chromosome 24 (position 19336539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTCTAAACCCTCATCTGAATTTCWTTCCCCTCTTTTTCAATCAGGY[C/T]AAGAAAAGCCTTCAGAGCAGGAGAGCAATGAGTCGAAGCATCCAGAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 692 1849 14 39
Genomic Location:
Chromosome 24 (position 19336419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACTCTTTGGACTCCACTGCATCATCAGGCATTGGGAGCTACAGCACR[C/T]AGATGTCCGGAACAGACAACCCKGAGCAGTTTGAGGTCCTCAAACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Essential Splice Site 958 1849 19 39
Genomic Location:
Chromosome 24 (position 19330411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCTTCACCAGCGCCACACATCTWGAGCATGTCAGACCAATGTTTAAGG[T/C]AWTCTCTTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa778
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 1167 1849 25 39
Genomic Location:
Chromosome 24 (position 19321296)
KASP Assay ID:
554-0683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCTGTGCGCTGTCTCGATGGATGAACTGGCCTCCCCAACACACCCT[C/T]GAATGTTCAGTCTGCAGAAGATCGTGGAGATTTCATACTACAATATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092783 Nonsense 1611 1849 35 39
Genomic Location:
Chromosome 24 (position 19301286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYTAATTTGATATTATGTTGTGTGTGTGCATTGTGCAGAAGCTCAGGAA[C/T]AGAGGCTGTTTGCTGCGCTACTCATYAAGTGTGTGGTTCAGCTGGAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gtxljtd8