A2AVI5_DANRE

Ensembl ID:
ENSDARG00000063451
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2AVI5]
Human Orthologue:
CCDC13
Human Description:
coiled-coil domain containing 13 [Source:HGNC Symbol;Acc:26358]
Mouse Orthologue:
Ccdc13
Mouse Description:
coiled-coil domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1920144]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25097 Nonsense Mutation detected in F1 DNA During 2014
sa1826 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092763 Nonsense 262 666 6 14
Genomic Location:
Chromosome 2 (position 1995705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTCAGCAGATTCTGTGTAACCCAGGAGGCTGGAGAGGGCGATCGCAG[C/T]AGATCCTCGCCCTGCAGAACCGAGTGAGTGTCCGCTGAGTGTTCAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092763 Nonsense 495 666 11 14
Genomic Location:
Chromosome 2 (position 2004488)
KASP Assay ID:
554-1818.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGAGATGCACWAGTGGCCTGTCCAGAGTGWGCTGTTAAAGTCCCCT[C/A]GCTCCAGGCGCAGTGTGCAGAGTATAAAACCCTTTACCAAAGCGCAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xaggm871