ENSDARG00000063444

Ensembl ID:
ENSDARG00000063444
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17634 Nonsense Available for shipment Available now
sa41940 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19022 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092746 Nonsense 76 322 2 4
Genomic Location:
Chromosome 12 (position 4854797)
KASP Assay ID:
2260-4853.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCCCTTTTTTNGTCTTCCTTGATGAAAGGTTTTATTTGACTGTGATTT[T/A]GGGACCAAAGACCCAGAATAAGTATGATCCCAGCCGAATCAGTAGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092746 Essential Splice Site 156 322 3 4
Genomic Location:
Chromosome 12 (position 4854110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAACCAGTGTTAAACAAGGGTTAAACAAGTTCTCCTGTATTTCCTGC[A/T]GTGCCGCTTCCATCCCCAAAGATTTTTCAGGAAGTGGAGGTGCCTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092746 Essential Splice Site 204 322 3 4
Genomic Location:
Chromosome 12 (position 4853961)
KASP Assay ID:
2260-4852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATGATTTGCGCTGGTCTGCTGAAGGAAGGCAAAGACTTGTGTCAGG[T/G]ACAGAAACCATGCTTAGTGTTTTCTTAAAAATTAAGCTGTCTTGGCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link