RPH3A (2 of 2)

Ensembl ID:
ENSDARG00000063436
Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Human Orthologue:
RPH3A
Human Description:
rabphilin 3A homolog (mouse) [Source:HGNC Symbol;Acc:17056]
Mouse Orthologue:
Rph3a
Mouse Description:
rabphilin 3A Gene [Source:MGI Symbol;Acc:MGI:102788]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24863 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9918 Essential Splice Site Available for shipment Available now
sa41577 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Essential Splice Site 177 597 5 16
Genomic Location (Zv9):
Chromosome 10 (position 3503445)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3495639
KASP Assay ID:
554-7443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATTTCAGAAAGCGTTCAGGTCACCGGCAGAGAGCAGCAGATATCTGG[T/C]AAGTGTCCCGCATTTCAATAACATTTAATATCAGCAAGAGGAAATGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Essential Splice Site 243 597 6 16
Genomic Location (Zv9):
Chromosome 10 (position 3503748)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3495942
KASP Assay ID:
2260-2779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTCCAGACCTCCAGYRTCCAGCTTTTCCACAACTCCAATACAAAAAG[G/T]TGAGAGAATTTATCATGTAGTGGTTATGATTCAGCATGGACAACTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092684 Nonsense 487 597 13 16
Genomic Location (Zv9):
Chromosome 10 (position 3515380)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3507574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGTGTCGTCCGATGTGCTCATCTGGCAGCAATGGACTCCAATGGCTA[T/A]TCAGACCCGTTTGTAAAGATGTAAGGAACTCTAACACGATCTAATTCGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link