TRPM4 (3 of 3)

Ensembl ID:
ENSDARG00000063435
Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Human Orthologue:
TRPM4
Human Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Mouse Orthologue:
Trpm4
Mouse Description:
transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27870 Essential Splice Site Mutation detected in F1 DNA During 2015
sa10730 Nonsense Available for shipment Available now
sa10961 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092687 Essential Splice Site 759 1176 20 29
Genomic Location:
Chromosome 12 (position 5477310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACCGTCTACTCCTTCAAAGACATCAAACACCAGTACATCAGCTTTTA[T/C]TCAGTACTTCATGCATACTTATGTCTGTCAACATCTACAAAACAGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092687 Nonsense 813 1176 21 29
Genomic Location:
Chromosome 12 (position 5477730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTSGACTTCAAGCCRCCTCCCCCTGAWGGCCCGGCGGTTTCGGAGTA[T/A]GTGCTGTAYTTCTGGGTCTTCACTTTAGTGTGCGAGGAGATTCGAGARGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092687 Nonsense 1117 1176 27 29
Genomic Location:
Chromosome 12 (position 5487144)
KASP Assay ID:
2260-4894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGAGAAYCTGCAGAAGGAGAACTATCTGGCCCTTGAGATCAAAAAA[C/T]AGAGAGGAACTGACKCTGAGAGGCTCAAACGCATAACTTCTAAGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ypjcys3l