TRPM4 (3 of 3)

Ensembl ID:
ENSDARG00000063435
Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Human Orthologue:
TRPM4
Human Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Mouse Orthologue:
Trpm4
Mouse Description:
transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10730 Nonsense Available for shipment Available now
sa10961 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092687 Nonsense 813 1176 21 29
Genomic Location:
Chromosome 12 (position 5477730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTSGACTTCAAGCCRCCTCCCCCTGAWGGCCCGGCGGTTTCGGAGTA[T/A]GTGCTGTAYTTCTGGGTCTTCACTTTAGTGTGCGAGGAGATTCGAGARGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092687 Nonsense 1117 1176 27 29
Genomic Location:
Chromosome 12 (position 5487144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGAGAAYCTGCAGAAGGAGAACTATCTGGCCCTTGAGATCAAAAAA[C/T]AGAGAGGAACTGACKCTGAGAGGCTCAAACGCATAACTTCTAAGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ypjcys3l