AP3B2

Ensembl ID:
ENSDARG00000063432
Description:
adaptor-related protein complex 3, beta 2 subunit [Source:HGNC Symbol;Acc:567]
Human Orthologue:
AP3B2
Human Description:
adaptor-related protein complex 3, beta 2 subunit [Source:HGNC Symbol;Acc:567]
Mouse Orthologue:
Ap3b2
Mouse Description:
adaptor-related protein complex 3, beta 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1100869]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30196 Nonsense Mutation detected in F1 DNA During 2016
sa37995 Nonsense Mutation detected in F1 DNA During 2016
sa10266 Nonsense Available for shipment Available now
sa32510 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092663 Nonsense 361 1102 10 26
Genomic Location (Zv9):
Chromosome 25 (position 6188719)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5599270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTTTGAATATGCAGCGTTTTGTCTTGTAGGGAATGTTTGAGCCGTA[T/A]CTGAAGAGTTTTTATATCCGCTCCACCGACCCGACGCAGATCAAAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092663 Nonsense 465 1102 13 26
Genomic Location (Zv9):
Chromosome 25 (position 6192278)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5595711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGAATCAGTGGTGGTGATCAAAAAGCTTCTCCAGATGCAGCCCGAG[C/T]AGCACAGTGACATCATCAAACACATGGCCAAACTCATCGACAACATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092663 Nonsense 839 1102 21 26
Genomic Location (Zv9):
Chromosome 25 (position 6206706)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5581283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATATAAACATGTATCATCTRTGTTTCTCAGTTGAACCGGCTCCAGCAT[C/A]GGCTCCGGTGACTCCAGTTAACTTCCTTTCCAGTAGTCTGGTGTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092663 Essential Splice Site 946 1102 23 26
Genomic Location (Zv9):
Chromosome 25 (position 6209371)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5578618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGGCGCTTTTCTGTGACTTTATTTTTGTACCGTCTGCATTGTTCTTTC[A/T]GAGGTGTTAGCGGCGAATGAATCGGTTACCGTGGTGATGGGAATAGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link