THBS1 (2 of 2)

Ensembl ID:
ENSDARG00000063430
Description:
thrombospondin 1 [Source:HGNC Symbol;Acc:11785]
Human Orthologue:
THBS1
Human Description:
thrombospondin 1 [Source:HGNC Symbol;Acc:11785]
Mouse Orthologue:
Thbs1
Mouse Description:
thrombospondin 1 Gene [Source:MGI Symbol;Acc:MGI:98737]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2906 Nonsense F2 line generated During 2016
sa22971 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32115 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36283 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2906
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092683 Nonsense 180 804 4 14
Genomic Location:
Chromosome 17 (position 510922)
KASP Assay ID:
554-2794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTGTGTGGGTGACTCCAAAGCAGCCCGAATGTGCAACGCTCAGWCCTG[T/A]CCTGTAGACGGCTGTCTCTCGAACCCGTGCTTCAGTGGAGCCAAATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092683 Essential Splice Site 350 804 7 14
Genomic Location:
Chromosome 17 (position 513412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCGCAGCATGTGAAAATCTTCAAAACTATGAACACACGTCCTCTTTC[A/T]GGATAACTGCCCTGACCTTCCCAACTCTGGACAAGAAGACTACGACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092683 Essential Splice Site 439 804 9 14
Genomic Location:
Chromosome 17 (position 517640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAATTGATGGATGGAAACACAGCCAGTGACGTTGTTATTTGTTTGTCC[A/T]GGCATTCTGAATGAGAAGGACAACTGTCCATATGTGTACAACACCGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092683 Nonsense 801 804 14 14
Genomic Location:
Chromosome 17 (position 521789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTCTTCTCTCAAGAGATGGTTTACTTCTCAGACCTCAAATACGAATG[C/A]AGAGGTAAAACTCAGTTGATTGCTTTTTTTTTTTTAAAGATTAATGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link