LOC570766

Ensembl ID:
ENSDARG00000063411
Human Orthologue:
C6orf154
Human Description:
chromosome 6 open reading frame 154 [Source:HGNC Symbol;Acc:21375]
Mouse Orthologue:
Gm88
Mouse Description:
predicted gene 88 Gene [Source:MGI Symbol;Acc:MGI:2684934]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42124 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092646 Nonsense 174 319 3 8
Genomic Location (Zv9):
Chromosome 13 (position 3613495)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3828315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCTCAGGGCTGGGCACGACTGGCCATCGCCGCGGCTCACAGCTCA[C/T]AATTACGGGTCCTCAACCTCGACTACAATCCCTTGGGTGAGTGACTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link