LOC570766

Ensembl ID:
ENSDARG00000063411
Human Orthologue:
C6orf154
Human Description:
chromosome 6 open reading frame 154 [Source:HGNC Symbol;Acc:21375]
Mouse Orthologue:
Gm88
Mouse Description:
predicted gene 88 Gene [Source:MGI Symbol;Acc:MGI:2684934]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42124 Nonsense Mutation detected in F1 DNA During 2016
sa3845 Nonsense Mutation detected in F1 DNA During 2016
sa7712 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092646 Nonsense 174 319 3 8
Genomic Location:
Chromosome 13 (position 3613495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCTCAGGGCTGGGCACGACTGGCCATCGCCGCGGCTCACAGCTCA[C/T]AATTACGGGTCCTCAACCTCGACTACAATCCCTTGGGTGAGTGACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092646 Nonsense 280 319 5 8
Genomic Location:
Chromosome 13 (position 3617159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGAGAGGCCCGCGGCAGCTCGGTGACGGCCCGAGAGAAACCCGCCTG[G/A]CTCCCGCACAGCAGTAAGGGCTGAACACTGCCTCAAATATCTCTGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092646 Essential Splice Site 296 319 8 8
Genomic Location:
Chromosome 13 (position 3620507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCTCTTCAAACATTACAGACATTTACCGAGTTGTYTCTGACCCTTCC[A/T]GACTCTTCCAGCTCCCAGATGGTCCTGATGACTTCAGGACTGRGTGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link