pvrl2l

Ensembl ID:
ENSDARG00000063390
ZFIN ID:
ZDB-GENE-060503-249
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L921]
Human Orthologues:
PVR, PVRL2
Human Descriptions:
poliovirus receptor [Source:HGNC Symbol;Acc:9705]
poliovirus receptor-related 2 (herpesvirus entry mediator B) [Source:HGNC Symbol;Acc:9707]
Mouse Orthologues:
Pvr, Pvrl2
Mouse Descriptions:
poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]
poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23432 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092609 Essential Splice Site 140 489 4 10
ENSDART00000144571 Essential Splice Site 120 488 3 6
Genomic Location (Zv9):
Chromosome 19 (position 7240595)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6699270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAAACCTCACGGTGAAACTCATTTAGTTTTTCTTTCTCTCCCTCA[G/C]CGAAACCTAAAAACTCGGCCACCGCCATCCCAGTGAGAGCAGGCACTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link