
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
pvrl2l
- Ensembl ID:
- ENSDARG00000063390
- ZFIN ID:
- ZDB-GENE-060503-249
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L921]
- Human Orthologues:
- PVR, PVRL2
- Human Descriptions:
- poliovirus receptor [Source:HGNC Symbol;Acc:9705]
- poliovirus receptor-related 2 (herpesvirus entry mediator B) [Source:HGNC Symbol;Acc:9707]
- Mouse Orthologues:
- Pvr, Pvrl2
- Mouse Descriptions:
- poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]
- poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23432 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23432
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092609 | Essential Splice Site | 140 | 489 | 4 | 10 |
ENSDART00000144571 | Essential Splice Site | 120 | 488 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 19 (position 7240595)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 6699270 GRCz11 19 6618301 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAAAAAACCTCACGGTGAAACTCATTTAGTTTTTCTTTCTCTCCCTCA[G/C]CGAAACCTAAAAACTCGGCCACCGCCATCCCAGTGAGAGCAGGCACTTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Insights into the genetic architecture of early stage age-related macular degeneration: a genome-wide association study meta-analysis. (View Study)
- Alzheimer's disease: A comprehensive genetic association study of Alzheimer disease in African Americans. (View Study)
- Alzheimer's disease: A genome-wide association study for late-onset Alzheimer's disease using DNA pooling. (View Study)
- Alzheimer's disease (age of onset): Genome-wide association analysis of age-at-onset in Alzheimer's disease. (View Study)
- Alzheimer's disease (late onset): Dementia revealed: novel chromosome 6 locus for late-onset Alzheimer disease provides genetic evidence for folate-pathway abnormalities. (View Study)
- Alzheimer's disease (late onset): SORL1 is genetically associated with late-onset Alzheimer's disease in Japanese, Koreans and Caucasians. (View Study)
- Alzheimer's disease biomarkers: APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. (View Study)
- Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
- Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
- Waist-to-hip circumference ratio (interaction): Gene-environment interactions and obesity traits among postmenopausal African-American and Hispanic women in the Women's Health Initiative SHARe Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: