sec22c

Ensembl ID:
ENSDARG00000063387
ZFIN ID:
ZDB-GENE-060227-2
Human Orthologue:
SEC22C
Human Description:
SEC22 vesicle trafficking protein homolog C (S. cerevisiae) [Source:HGNC Symbol;Acc:16828]
Mouse Orthologue:
Sec22c
Mouse Description:
SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2447871]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37875 Nonsense Mutation detected in F1 DNA During 2017
sa8381 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7516 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092591 Nonsense 33 305 1 6
ENSDART00000142848 Nonsense 33 303 2 7
Genomic Location (Zv9):
Chromosome 24 (position 21268446)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20515575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCTCTCCGCCTCCACTGATTTCCTGCATAACAAGGAACTTCAGGAG[A/T]AAAAGCAACAGATTAAAATCATCTCGAAATCCTTGAATGTCTTACCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092591 Essential Splice Site 61 305 1 6
ENSDART00000142848 Essential Splice Site 61 303 2 7
Genomic Location (Zv9):
Chromosome 24 (position 21268532)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20515661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCTTACCAGAGAGAGGGACAGTCAAGGGCCATGAGCTCAACATTCA[G/A]TAAGTGCACTATAGTGTCTTRAGCTTAAGTCACCCCATATTATTACCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092591 Missense 109 305 2 6
ENSDART00000142848 Missense 109 303 3 7
Genomic Location (Zv9):
Chromosome 24 (position 21270518)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20517647
KASP Assay ID:
554-4143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATTCACAGCATGCTTTGACAACTCTGCAGTGGCCATGGCAAACAGGC[C/T]GTACCCATTTCTGGAGTTTGGTAGGGTGATTAAAATKTTAATGGATGTAW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link