ERMP1 (2 of 2)

Ensembl ID:
ENSDARG00000063373
Description:
endoplasmic reticulum metallopeptidase 1 [Source:HGNC Symbol;Acc:23703]
Human Orthologue:
ERMP1
Human Description:
endoplasmic reticulum metallopeptidase 1 [Source:HGNC Symbol;Acc:23703]
Mouse Orthologue:
Ermp1
Mouse Description:
endoplasmic reticulum metallopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:106250]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37198 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092551 Nonsense 217 577 3 7
Genomic Location (Zv9):
Chromosome 21 (position 1388855)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1093256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGCTGCTCCGTGATGTTGGAGGTTTTACACTCTCTGGCGAATCTCT[C/A]GACTCCAATCAAACACGGCGTCATCTTCCTGTTCAACGGTGCAGAGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link