si:ch211-129c2.7

Ensembl ID:
ENSDARG00000063371
ZFIN ID:
ZDB-GENE-090313-21
Human Orthologue:
RASA3
Human Description:
RAS p21 protein activator 3 [Source:HGNC Symbol;Acc:20331]
Mouse Orthologue:
Rasa3
Mouse Description:
RAS p21 protein activator 3 Gene [Source:MGI Symbol;Acc:MGI:1197013]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25499 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39527 Nonsense Mutation detected in F1 DNA During 2017
sa19394 Essential Splice Site Available for shipment Available now
sa19393 Nonsense Available for shipment Available now
sa19392 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092524 Essential Splice Site 261 833 9 24
Genomic Location (Zv9):
Chromosome 1 (position 246233)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 376363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGGTGCCGCTGAAGGTGCTGGGACAGGCGGGTGTTCACGATGCATGG[T/G]ATGAGCCTCATCATGTGTGTGTTCAGTCTGAGAGAGATGGAAATGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092524 Nonsense 288 833 10 24
Genomic Location (Zv9):
Chromosome 1 (position 245357)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 375487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAGTGAAGGCGGATGAGCTGGGCTCGCTGAGACTCAACATCGTTTA[C/A]ACGGAGGACCACGTGTTCCCGACGGAGCATTACAACCCGCTGCGAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092524 Essential Splice Site 555 833 17 24
Genomic Location (Zv9):
Chromosome 1 (position 240033)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 370163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTACGACTACTTCAATGAGCAGAAGTACGCAGACGCAGTGAAGAAC[G/A]TGAGTGTGTGTGTGTGTCTGTTTGTGTGTGTGAGTGTGTGTGTGTCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092524 Nonsense 736 833 22 24
Genomic Location (Zv9):
Chromosome 1 (position 236009)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 366139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGGATGTGGATGGAGATCGAGAGACGGAGAGGATCTACTCGCTCTA[C/A]AGCACATACATGTCCAAACTGGTGAAGATGCAGGGTGAGTCCAACACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092524 Nonsense 773 833 23 24
Genomic Location (Zv9):
Chromosome 1 (position 235113)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 365243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACGGGCCGGAGCAGGAGGAATACTCTACGTTTGTGATCGATGACCCG[C/T]AGGAAACCTATAAAACCCTGAGACTCGTGATCTCCGCCGTGCAGACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link