KIAA1432 (2 of 2)

Ensembl ID:
ENSDARG00000063362
Description:
KIAA1432 [Source:HGNC Symbol;Acc:17686]
Human Orthologue:
KIAA1432
Human Description:
KIAA1432 [Source:HGNC Symbol;Acc:17686]
Mouse Orthologue:
C030046E11Rik
Mouse Description:
RIKEN cDNA C030046E11 gene Gene [Source:MGI Symbol;Acc:MGI:1924893]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12886 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082377 Essential Splice Site 810 1191 28 33
Genomic Location:
Chromosome 21 (position 928380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGGTGGAGAGAACATCAMAGATATACCYGCAYCACATACTAAGACAGG[T/A]AATATTACAGTTCAGCATGTTTAAAGGAGACCTGTTATRCTGCTCTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yi7bl213