si:ch211-1e14.1

Ensembl ID:
ENSDARG00000063361
ZFIN ID:
ZDB-GENE-050420-149
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LY95]
Human Orthologue:
KIAA1549
Human Description:
KIAA1549 [Source:HGNC Symbol;Acc:22219]
Mouse Orthologue:
D630045J12Rik
Mouse Description:
RIKEN cDNA D630045J12 gene Gene [Source:MGI Symbol;Acc:MGI:2669829]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18360 Nonsense Available for shipment Available now
sa11060 Nonsense Available for shipment Available now
sa43062 Nonsense Mutation detected in F1 DNA During 2017
sa43061 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16982 Nonsense Available for shipment Available now
sa36589 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16764 Nonsense Available for shipment Available now
sa36588 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 119 1726 2 20
ENSDART00000144799   None 966 None 18
Genomic Location (Zv9):
Chromosome 18 (position 11866707)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12449436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGTGCATTTATCTTGGTCCGCTATCAGCCCAGATCCTCAAATCTCAT[C/A]AGCTACAGATTCATCTGTTTCTTCTCACTTGCCTTTACTTGGACAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 369 1726 2 20
ENSDART00000144799   None 966 None 18
Genomic Location (Zv9):
Chromosome 18 (position 11865956)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12448685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGYAACAGCAGTTCTTTATCTATTTCAACCATCCAACTAACTAGAGTCYA[T/A]TCAGAGTCTACGACAGTTGTGCCCTTTACKAYGTCACCACCTCCAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 642 1726 2 20
ENSDART00000144799   None 966 None 18
Genomic Location (Zv9):
Chromosome 18 (position 11865138)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12447867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTCCCAATGGAGACTGTATTACCTAGCAGTGTACTTCCCAGTGTTT[T/A]AGCAACCACCTCTATCAGTGTTTCTGAATACCCAGATAACTCAACCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Essential Splice Site 782 1726 4 20
ENSDART00000144799 Essential Splice Site 22 966 2 18
Genomic Location (Zv9):
Chromosome 18 (position 11863594)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12446323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACATTTCCTTCACATCATGTGTTTACAATACGCTTTTTGTGTTTACT[A/G]GGTAGTGAAAGCTCCTCCAGACTTTGTGTTTCGCGCTGTGTCTGGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 851 1726 5 20
ENSDART00000144799 Nonsense 91 966 3 18
Genomic Location (Zv9):
Chromosome 18 (position 11860583)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12443312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTGCAGTGCTTCAGTTTGTGCCAAGCCAWGTAGATGTGCGTATGTG[T/A]ACCTTCAGTGAGCARGCAGARAAAGGTCTWATTGCTGCATTAGCTGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Essential Splice Site 965 1726 7 20
ENSDART00000144799 Essential Splice Site 205 966 5 18
Genomic Location (Zv9):
Chromosome 18 (position 11857788)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12440517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGAGCTGAACACAACCCAGCTGCTTCGTTCCTCATGGGTCAGAACAG[G/A]TAATATTTCTTAACACTTTTTTATTCCAAAATAAACTAGCATTAAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 1017 1726 9 20
ENSDART00000144799 Nonsense 257 966 7 18
Genomic Location (Zv9):
Chromosome 18 (position 11848349)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12431078
KASP Assay ID:
2261-1917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGTGTGAACAAGCCATTTTTTTTNCTWCCCACTTCATTTAGATCGTA[C/T]AGACRACCCATCTTGTAGGGCCAGACAACCCTCTGGAGATCATCTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092522 Nonsense 1571 1726 18 20
ENSDART00000144799 Nonsense 811 966 16 18
Genomic Location (Zv9):
Chromosome 18 (position 11815461)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12398190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTTGGAGTGCAGTGTGGGTATCTGATGTTTTTGTGTCTCTACAGA[C/T]AGGGATTGGGGTCCAGCTATATGCCATCAGGAGAATCTCTGCCTGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link