inpp4a

Ensembl ID:
ENSDARG00000063352
ZFIN ID:
ZDB-GENE-060312-5
Description:
type I inositol-3,4-bisphosphate 4-phosphatase [Source:RefSeq peptide;Acc:NP_001035062]
Human Orthologue:
INPP4A
Human Description:
inositol polyphosphate-4-phosphatase, type I, 107kDa [Source:HGNC Symbol;Acc:6074]
Mouse Orthologue:
Inpp4a
Mouse Description:
inositol polyphosphate-4-phosphatase, type I Gene [Source:MGI Symbol;Acc:MGI:1931123]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25416 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41352 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31700 Nonsense Available for shipment Available now
sa38723 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092480 Essential Splice Site 349 931 11 22
ENSDART00000114731 Essential Splice Site 349 385 12 12
ENSDART00000127959 Essential Splice Site 349 936 11 23
ENSDART00000135576 Essential Splice Site 76 145 5 7
ENSDART00000148047 Essential Splice Site 349 385 11 11
ENSDART00000148181 Essential Splice Site 349 937 11 23
Genomic Location (Zv9):
Chromosome 9 (position 7087882)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7067975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTTTACATAATTTTTTTATTTTTATTTTTTACAAAATTTCTGAACA[G/A]ATCGCACATATGACGTAGTGACCACAGGGGCTCCTGCTGCACACCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092480 Essential Splice Site 567 931 14 22
ENSDART00000114731   None 385 None 12
ENSDART00000127959 Essential Splice Site 572 936 15 23
ENSDART00000135576   None 145 None 7
ENSDART00000148047   None 385 None 11
ENSDART00000148181 Essential Splice Site 573 937 15 23
Genomic Location (Zv9):
Chromosome 9 (position 7098588)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7078681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAAGACGTGTTTCTGTCGGACCAGCAGGCCGACACCAGCAAGAGAG[G/A]TAGCAAGGGCAATGCATTCTGGATCAACCCTGGTGACGGGCTCTCGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092480 Nonsense 800 931 20 22
ENSDART00000114731   None 385 None 12
ENSDART00000127959 Nonsense 805 936 21 23
ENSDART00000135576   None 145 None 7
ENSDART00000148047   None 385 None 11
ENSDART00000148181 Nonsense 806 937 21 23
Genomic Location (Zv9):
Chromosome 9 (position 7105649)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7085742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGGTTATTTTTTAGTCCTCACCTCTTGAATGCCTCCTCCATAGGTT[T/A]GCCACGCTCTCGCAGTCAAAACTGTGTGCCTGAGCTTCTCCGGTTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092480 Nonsense 865 931 21 22
ENSDART00000114731   None 385 None 12
ENSDART00000127959 Nonsense 870 936 22 23
ENSDART00000135576   None 145 None 7
ENSDART00000148047   None 385 None 11
ENSDART00000148181 Nonsense 871 937 22 23
Genomic Location (Zv9):
Chromosome 9 (position 7107883)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7087976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAGTGCAAAGGATCGGACGGCCATGTCGGTGACACTGGAGCAGTG[T/A]CAGATCCTCCAGAGTGAGCACTGCATGGCCCCGCAGGTCTTCACGCAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link