TRPM4 (2 of 3)

Ensembl ID:
ENSDARG00000063347
Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Human Orthologue:
TRPM4
Human Description:
transient receptor potential cation channel, subfamily M, member 4 [Source:HGNC Symbol;Acc:17993]
Mouse Orthologue:
Trpm4
Mouse Description:
transient receptor potential cation channel, subfamily M, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35196 Nonsense Mutation detected in F1 DNA During 2016
sa22008 Nonsense Available for shipment Available now
sa41947 Nonsense Mutation detected in F1 DNA During 2016
sa10854 Essential Splice Site Available for shipment Available now
sa18122 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092492 Nonsense 149 1109 3 25
Genomic Location (Zv9):
Chromosome 12 (position 5151891)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4430946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGGACTACTCGCCATAAAGGTGGAGAGCTGGCGTTCAGAGCCCGTCTG[G/T]AGGATTACATTTCACACCAGCGCCCAGGTACAGCATAAACCTGAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092492 Nonsense 442 1109 9 25
Genomic Location (Zv9):
Chromosome 12 (position 5143103)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4422166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGTCTGAACTCTCGTTGTACGCAGGATCGACTAGAAGAAAAGACATA[A/T]AGGTACCAGACCCCATTTTAAAATCTGTGTAGTCTAAAAACACACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092492 Nonsense 585 1109 13 25
Genomic Location (Zv9):
Chromosome 12 (position 5136667)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4415730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTAACAGTCTTTTTTTTTGTTCAGTCTCTGCTGTCTCAGATCTGGTG[G/A]GGAGATATAGAGAGAGATACTGCGCTTTGGAAAGTGCTGCTGGTGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092492 Essential Splice Site 944 1109 21 25
Genomic Location (Zv9):
Chromosome 12 (position 5084419)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4367046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTATAARWGACTGTCAAATCATCTGTGTGTTGCTTTGTGTTTTNCTGC[A/T]GCTAWACGTTTACKAAGGTTCAGGAGCACAGCGACAAATACTGGAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092492 Essential Splice Site 1104 1109 24 25
Genomic Location (Zv9):
Chromosome 12 (position 5078807)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4361434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCWCAGAGCAGCACAGCGAASAGCACTAAAGCACATCCTACTCGCAAAG[G/A]TAAAAACTGCWGATACTTATCTCAACACTTACAAATATGATAACAGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link