si:ch211-284b7.3

Ensembl ID:
ENSDARG00000063341
ZFIN ID:
ZDB-GENE-061207-34
Description:
hypothetical protein LOC555997 [Source:RefSeq peptide;Acc:NP_001122157]
Human Orthologue:
C1orf123
Human Description:
chromosome 1 open reading frame 123 [Source:HGNC Symbol;Acc:26059]
Mouse Orthologue:
0610037L13Rik
Mouse Description:
RIKEN cDNA 0610037L13 gene Gene [Source:MGI Symbol;Acc:MGI:1921348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32836 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092479 Nonsense 140 160 8 8
ENSDART00000134818 Nonsense 138 158 7 7

The following transcripts of ENSDARG00000063341 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5684648)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6130376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCAGGGTGTAACACCCTTGTGTTTATGTTACAGGACTGGACGGACTA[T/A]GATGAGAAGGCCAGCGAGTCTGTGGGTATCTATGAGGTCACACATCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link