si:ch73-250d21.1

Ensembl ID:
ENSDARG00000063337
ZFIN ID:
ZDB-GENE-030131-5554
Description:
glutamate receptor interacting protein 2 [Source:RefSeq peptide;Acc:NP_001116760]
Human Orthologue:
GRIP1
Human Description:
glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
Mouse Orthologue:
Grip1
Mouse Description:
glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21193 Essential Splice Site Available for shipment Available now
sa41117 Nonsense Mutation detected in F1 DNA During 2017
sa883 Nonsense F2 line generated During 2017
sa15003 Essential Splice Site Available for shipment Available now
sa21192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Essential Splice Site 176 736 None 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7797421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7184224
KASP Assay ID:
2260-0125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCCGGCTGCCATCCGCTTTATAGAGCCTGACACACCTGCTGAACGG[T/C]GAGAGCAGAGCGCACCTCATGTGTGCTCAACACACTGTGCAATTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 404 736 10 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7786175)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7172978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAGGGCAAACCTCTGAGCGAAGCCATTCACCTGCTGCAGACCGCT[G/T]GAGACACGGTCACACTCAAGATCAAGAAACGATCCGACCGTAAGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa883
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 497 736 12 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7783006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7169809
KASP Assay ID:
554-0790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTATATATTCATAGGCCATCAGACTTCACTCTTCATCCCAGCGACTG[G/A]AGACAGACCAATCACAGGAGCCCGCTGATGTCAAGAAGACCCGCCCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Essential Splice Site 626 736 14 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7776559)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7163362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGGACCTRAAGGRGAACAGCCCGTCAGTGCCTCTAGAGCTTCATAAG[G/A]TAATGTTCACCTTCCAGCAGCTGGATTCACGTCTTGAACTCTTGCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 718 736 16 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7776060)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7162863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTCATTAGCAGGAATCCTCTCGCTCAGGCGCACGACTGGCCACCT[A/T]AAGACTGTCAGGACACTTCCCAACAGTCTGCACAAAATCCAAGAAAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link