shank3a

Ensembl ID:
ENSDARG00000063332
ZFIN ID:
ZDB-GENE-060503-369
Description:
Novel protein similar to vertebrate SH3 and multiple ankyrin repeat domains 3 (SHANK3) [Source:UniPr
Human Orthologue:
SHANK3
Human Description:
SH3 and multiple ankyrin repeat domains 3 [Source:HGNC Symbol;Acc:14294]
Mouse Orthologue:
Shank3
Mouse Description:
SH3/ankyrin domain gene 3 Gene [Source:MGI Symbol;Acc:MGI:1930016]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16683 Essential Splice Site Available for shipment Available now
sa17971 Nonsense Available for shipment Available now
sa8619 Nonsense Mutation detected in F1 DNA During 2017
sa8445 Nonsense Mutation detected in F1 DNA During 2017
sa25052 Nonsense Mutation detected in F1 DNA During 2017
sa16870 Nonsense Available for shipment Available now
sa43043 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23228 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Essential Splice Site 214 1467 4 12
ENSDART00000139188 Essential Splice Site 101 185 3 4
ENSDART00000139505 Essential Splice Site 101 1353 3 11
Genomic Location (Zv9):
Chromosome 18 (position 7168902)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7746592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATTACGACGATGCATGTTAATGTGTGTGATGTTGTGTTTTTTCTKTC[A/T]GAGACRAGAGAGGATCGAAACAAGAGGCTRTTCAGACATTACACTGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 553 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 439 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7138269)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7715959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGCCGAGACTACATGCATTGCCTCAGACAATGTCTGCTGAGCTGTA[T/G]GAGCCGCCTCGCCATGCCTCCCACATGGAGAGGCAGAAGAAAGCCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 611 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 497 1353 10 11
ENSDART00000092456 Nonsense 611 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 497 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7138095)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7715785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCRCCTGAGAGAATCAAGCGGAAAGGCAGAATCATAGATAACCCCTA[C/A]GCCAATGTGGGTCAGTTCAGCGTGGGTATGTTCACGCCAACTCCCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 611 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 497 1353 10 11
ENSDART00000092456 Nonsense 611 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 497 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7138095)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7715785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCRCCTGAGAGAATCAAGCGGAAAGGCAGAATCATAGATAACCCCTA[C/A]GCCAATGTGGGTCAGTTCAGCGTGGGTATGTTCACGCCAACTCCCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 952 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 838 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7137074)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7714764
KASP Assay ID:
554-7631.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTCCCCTAAGGGGATATTGTCAGAAAGCCCCAAACCCATGTTGGCC[G/T]AAATTAAACGTGCAAAGTCCCCTGGTCCCGAAGCTCCTTCGATATCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 1189 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 1075 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7136363)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7714053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCCAGCTCAGCAAGGGCCCGGTGACGTTCAGGGACCCCCTGCTCAAG[C/T]AGTCATCTGATAGCGAACTGCTCTCAMAGCAGCATGCGGCTGCACTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Essential Splice Site 1285 1467 11 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Essential Splice Site 1171 1353 10 11
Genomic Location (Zv9):
Chromosome 18 (position 7136073)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7713763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAGCTTCACTTGACCCCGGACGAAAATCCCCCGTGGTCGGTCCAAG[G/A]TAAAGTGCGAATCTTACAGGAGAGCATTCAATCAGCAATTTTTCAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092456 Nonsense 1407 1467 12 12
ENSDART00000139188   None 185 None 4
ENSDART00000139505 Nonsense 1293 1353 11 11
Genomic Location (Zv9):
Chromosome 18 (position 7127360)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7705050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCCTGCGGCCGTTCCACCAGAAACCCCTTCATCTGTGGAACAAGTA[C/A]GACGTGGGAGACTGGCTGGCCAGCATTAACCTGGCCGAACACCGGGATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link