mgat4a

Ensembl ID:
ENSDARG00000063330
ZFIN ID:
ZDB-GENE-070912-27
Description:
Novel protein similar to vertebrate mannosyl (Alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyl
Human Orthologue:
MGAT4A
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A [Source:HGNC
Mouse Orthologue:
Mgat4a
Mouse Description:
mannoside acetylglucosaminyltransferase 4, isoenzyme A Gene [Source:MGI Symbol;Acc:MGI:2662992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8425 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2014
sa21431 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092435 Essential Splice Site 32 533 1 15
ENSDART00000133638 Splice Site None 537 None 13
Genomic Location:
Chromosome 9 (position 7254394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCGTTTCTCAGTCTGTCCTGGTACACGGCTTGGCAAAATGGCAAAGG[T/C]GAGTCTCATCTGTGAGATCAGCTGTCAAATTGGGGTAAAGYTGGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092435 Nonsense 256 533 7 15
ENSDART00000133638 Nonsense 255 537 7 13
Genomic Location:
Chromosome 9 (position 7156758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGACTATTCTTTTCTTATGATGTATGCTGTCAACAAAGGGGTCTATTA[T/A]GTCCAGGTAAATCAAATGAGTGAGTTTAAAGGTGAAGCTGGTGATCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association of bipolar disorder suggests an enrichment of replicable associations in regions near genes. (View Study)
  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gh917mv8