si:ch73-216m24.3

Ensembl ID:
ENSDARG00000063319
ZFIN ID:
ZDB-GENE-100921-70
Human Orthologue:
SQLE
Human Description:
squalene epoxidase [Source:HGNC Symbol;Acc:11279]
Mouse Orthologue:
Sqle
Mouse Description:
squalene epoxidase Gene [Source:MGI Symbol;Acc:MGI:109296]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17167 Essential Splice Site Available for shipment Available now
sa23439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092408 Essential Splice Site 361 485 9 11
ENSDART00000132505 Essential Splice Site 349 480 8 10
Genomic Location (Zv9):
Chromosome 19 (position 7928288)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7386827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTTTCATTAATACAATTGTTTYTAATRATGAGAGTTTGCATCCAC[A/C]GGCTAAAAAGACATTCGACTGGGAGCGTAAGCTTTCTCATTCGTTTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092408 Nonsense 394 485 10 11
ENSDART00000132505 Nonsense 382 480 9 10
Genomic Location (Zv9):
Chromosome 19 (position 7929336)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7387875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATTTAACGATGATTTAAATCAGACTTTTTTATCTCCTTTAACAGATT[C/A]AATTCTGTATCTTCGAAGAGCCTGCCTGTGTTATTTTCAGTTAGGAGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link