LOC100334116

Ensembl ID:
ENSDARG00000063316
Human Orthologue:
HGF
Human Description:
hepatocyte growth factor (hepapoietin A; scatter factor) [Source:HGNC Symbol;Acc:4893]
Mouse Orthologue:
Hgf
Mouse Description:
hepatocyte growth factor Gene [Source:MGI Symbol;Acc:MGI:96079]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25053 Nonsense Mutation detected in F1 DNA During 2014
sa18536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092421 Nonsense 149 377 4 9
Genomic Location:
Chromosome 18 (position 9387426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACGGGATAATTTATGTCGTAATCCGGACAACACCACAACGGGTCCTT[G/A]GTGTTTTACCACAGACCCCAAACTACGTCACCAAGACTGCAGCATCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092421 Nonsense 180 377 5 9
Genomic Location:
Chromosome 18 (position 9385238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGTTCTTTATCCGTAGTGGAATGTATGACGTGTAACGGAGAAAGTTA[T/A]CGTGGACCCTTGGACCACACGGAGAGTGGYCGGGAATGCCAGCGCTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kdb6qd7y