ENSDARG00000063315

Ensembl ID:
ENSDARG00000063315

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44423 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44424 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092422 Essential Splice Site 11 217 1 3
ENSDART00000128033   None 253 None 4
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 6699)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5159760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAATTTCGTGGACTTTGCCTGTTTAGTAGGCTAACTCTTGCTTTAA[G/A]TCCTTTGTAGACAAAGCTTAAGATTAGTCCAAATAGGTCTGCTTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092422 Nonsense 89 217 2 3
ENSDART00000128033 Nonsense 97 253 2 4
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 9237)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5157222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTCTTGATGGGAGATTCAGAGACAGACTGAAACTGGACAGTAAAACA[G/T]GATCTCTGACTATGAGAAACACTACAGTCGCAGACTCTGGACTTTACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link