tjp2a

Ensembl ID:
ENSDARG00000063309
ZFIN ID:
ZDB-GENE-070925-2
Human Orthologue:
TJP2
Human Description:
tight junction protein 2 (zona occludens 2) [Source:HGNC Symbol;Acc:11828]
Mouse Orthologue:
Tjp2
Mouse Description:
tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 831 1198 16 22
ENSDART00000136789 Nonsense 831 1198 18 24
Genomic Location (Zv9):
Chromosome 10 (position 15855121)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15868428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGGATGTCACTCCAAAGGCTGTAGACACCCTCAATTACACTCAGTG[G/A]TATCCCATTGTCATCTTCCTCAACCCAGACAGCAAGCAGGGGGTGAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link