tjp2a

Ensembl ID:
ENSDARG00000063309
ZFIN ID:
ZDB-GENE-070925-2
Human Orthologue:
TJP2
Human Description:
tight junction protein 2 (zona occludens 2) [Source:HGNC Symbol;Acc:11828]
Mouse Orthologue:
Tjp2
Mouse Description:
tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4364 Nonsense Mutation detected in F1 DNA During 2014
sa4337 Nonsense Mutation detected in F1 DNA During 2014
sa18981 Nonsense Mutation detected in F1 DNA During 2014
sa13709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 432 1198 7 22
ENSDART00000136789 Nonsense 432 1198 9 24
Genomic Location:
Chromosome 10 (position 15863527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNTGCAGACATCTCTGAGATCGAGTCGTACCGCTCATATTCTCCT[C/T]AGGAGGATCGGCGGAGTCATCACTCAGACCTCTCCTCACACTCCTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
Genomic Location:
Chromosome 10 (position 15858460)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTCAAGAGGACAGTCCTGCCGAGGTGGAGGGTCTGCGCACTGGAGAC[C/T]AAATAGTCAAGGTCWGGATTGCACGCTGCACAAGGCGAAATTGCGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
ENSDART00000092343 Nonsense 577 1198 10 22
ENSDART00000136789 Nonsense 577 1198 12 24
Genomic Location:
Chromosome 10 (position 15858460)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTCAAGAGGACAGTCCTGCCGAGGTGGAGGGTCTGCGCACTGGAGAC[C/T]AAATAGTCAAGGTCAGGATTGCACGCTGCACAAGGCGAAATTGCGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092343 Nonsense 831 1198 16 22
ENSDART00000136789 Nonsense 831 1198 18 24
Genomic Location:
Chromosome 10 (position 15855121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGGATGTCACTCCAAAGGCTGTAGACACCCTCAATTACACTCAGTG[G/A]TATCCCATTGTCATCTTCCTCAACCCAGACAGCAAGCAGGGGGTGAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/liq4p4f0