SGSM2

Ensembl ID:
ENSDARG00000063307
Description:
small G protein signaling modulator 2 [Source:HGNC Symbol;Acc:29026]
Human Orthologue:
SGSM2
Human Description:
small G protein signaling modulator 2 [Source:HGNC Symbol;Acc:29026]
Mouse Orthologue:
Sgsm2
Mouse Description:
small G protein signaling modulator 2 Gene [Source:MGI Symbol;Acc:MGI:2144695]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7402 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092357 Missense 571 1056 15 24
Genomic Location (Zv9):
Chromosome 15 (position 19590054)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20692680
KASP Assay ID:
554-4372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTRAAGGGCTGGCCTACTGTCGGCATCTGTCAACAGTGAGAACACA[T/G]CTTTCAGCGCTGGTCAACCACAACATCGTTCCCCCGGACAAGCCCTGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac structure and function: Genetic variants associated with cardiac structure and function: a meta-analysis and replication of genome-wide association data. (View Study)
  • Proinsulin levels: Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link