Q1RLV3_DANRE

Ensembl ID:
ENSDARG00000063300
Description:
LOC567075 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLV3]
Human Orthologue:
SEC16A
Human Description:
SEC16 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:29006]
Mouse Orthologue:
Sec16a
Mouse Description:
SEC16 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2139207]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25033 Nonsense Mutation detected in F1 DNA During 2017
sa39130 Nonsense Mutation detected in F1 DNA During 2017
sa12789 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Nonsense 131 1097 3 26
Genomic Location (Zv9):
Chromosome 16 (position 55590515)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52080659
KASP Assay ID:
554-7564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGCCTACGATGCCACTGGCACCACTCTTCCAGCAGATTACACCTA[C/A]AGCCAGTATCCTAACCCTTCAGATACTGTGAATTATGGTCAGGATCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Nonsense 617 1097 15 26
Genomic Location (Zv9):
Chromosome 16 (position 55564860)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52056317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCGATCATCTGCATGGTATTGTCCCATTCAGGAGGGTGTGATCTCTT[T/A]GCGTACGGACCGCAGCACCCCACAGCTTTACCCCTGCAGTACACCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092348 Essential Splice Site 956 1097 21 26
Genomic Location (Zv9):
Chromosome 16 (position 55559349)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52050806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGGCCCACCATCAGGGCCTCCTGTGAACATGTTCTCCARAAGAGCAGG[T/A]GCCGTTACCAGGAATTATACCTCTTTTACCCTYCTAAYCACTTAYGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link